| Id Trinity | FTRINITY_DN58652_c2_g1_i3 |
|---|---|
| Name Transcript | Ll_transcript_179250 |
| Sequence | CTCTTTCAAGAACAGAAATTGCCACAAGGTCTCATAAAAGCAATAAAGTTGGATGTCTTAAATGAGGCGGATATAGATAAAATCGCTGCTTTGGAGATAA ATGCAGCCGGGCAGGTCAACTGTTCTGACCTGGGACTCCCAAATCTATCTTCCGAGTGCACAACATGTGGCGGTAAATCTTCGGATAAAAATTCTTGTGA AGGTCATTATGGAGTAATTAAATTTCCTTTTGTCATACTCCATCCATATTTTATGTCAGAGATTGCAAAAATCTTGAACAAAATTTGCCCTGGATGTAAA TCTATTCGACGAGAATTACAGAACAAGTTGAAGTATAAAAGCACTTACTTGTGGTCCTTGCTTCTGAGTTCTGACCATTTGAATAAGTGATTCTATAAGA TTTTATTCCGTGCATGCTGCTCAATTACTCTCTGGATTCAAGCAGTTTAACGGTTGCAAATATTGTTCTGGAAATTCTATGGTTCGCTATCCAACAATGA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_78904; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_179250
| Blastp | DNA-directed RNA polymerase IV subunit 1 from Arabidopsis with 49.51% of identity |
|---|---|
| Blastx | DNA-directed RNA polymerase IV subunit 1 from Arabidopsis with 49.51% of identity |
| Eggnog | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates (By similarity)(COG0086) |
| Kegg | Link to kegg annotations (AT1G63020) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019445104.1) |
| Pfam | RNA polymerase Rpb1, domain 1 (PF04997.11) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |