Id Trinity | FTRINITY_DN58683_c1_g1_i15 |
---|---|
Name Transcript | Ll_transcript_179643 |
Sequence | CTTCTCAGCGTGTCAGGTGAACAATATAGCTGATTTATGGTGACACACATGATATATGGACAAAGCTAGAAATACATTTGTTTACTCTTTTTGGCCATCA ATGGAATTTGCTCATGGTCTAGCACTAGTCAATTTAATGTTTCCCATGTCTCTACAACTAATGTCCGAATTTGATTTTTGTAGGTCCCCAGAAACGCCTG TGTTAGATTCAGGGATTACCAATGCCTTACATGACTCCTCTTTGCTGACAAATAATGTGAACCTTGTTGAAAGTAATCATGACTCAAATTCTTTCTCCAC TGACCCTATAGCTGACAAAATAGCAACAGATTCCAGAGCGCTAGTTACTGTTCCAACTAGGAGCACAAAAGCATTAGCTGTGGTTCCTGCTAGTCAGAAA ACCAGGCACTCTGAGCTTGTACAGCGTCG BLAST |
Tissue | flowers |
Gene name | LI_gene_79177; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_179643
Blastp | Telomere repeat-binding protein 3 from Arabidopsis with 39.02% of identity |
---|---|
Blastx | Telomere repeat-binding protein 3 from Arabidopsis with 39.02% of identity |
Eggnog | Telomere repeat-binding protein(ENOG4111C5T) |
Kegg | Link to kegg annotations (AT3G12560) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019455794.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |