Id Trinity | FTRINITY_DN58705_c0_g2_i2 |
---|---|
Name Transcript | Ll_transcript_35862 |
Sequence | CTCAAATTTCTCTCGTCTTCTCTGCTGAAAAACAAAACACAGAAAGTTTAAGCAAATAGTATATTCCTCAATCCTTATCCGTTTCGTTGCTTCTGGAACC TTCTAGAACATGGAACGCATCGTTGGTGGCAAGTTCAAGCTTGGCCGCAAGATCGGAAGTGGATCCTTCGGTGAAATTTACCTCGCTACGCATATCGATA CCTTTGAGATCGTCGCCGTCAAGATCGAGAACAGTAAAACAAAGCATCCGCAATTGCTTTATGAGGCGAAGCTCTATAATATTCTTCAAGGAGGAAGTGG GATTCCGAGCATAAAATGGTTTGGCGTAGATGGGGAGGAAAATGTGCTTGTTATTGATTTGCTGGGGCCGAGTCTTGAGGATCTCTTTGTGTATTGTGGA AGGAAGTTCTCATTGAAGACAGTGTTAATGTTGGCTGATCAAATGATCACTAGAGTAGAATATGTGCATTCTAAAGGATATTTACATCGGGATATAAAGC CTGATAACTTTCTCATGGGACTTGGTCGGAAGGCCAACCAGGTTTACATAATTGATTATGGGCTT BLAST |
Tissue | flowers |
Gene name | LI_gene_79357; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_35862
Blastp | Casein kinase 1-like protein 3 from Arabidopsis with 88.82% of identity |
---|---|
Blastx | Casein kinase 1-like protein 3 from Arabidopsis with 88.82% of identity |
Eggnog | Casein Kinase(ENOG410XPGP) |
Kegg | Link to kegg annotations (AT4G28880) |
CantataDB | Link to cantataDB annotations (CNT0000756) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019446348.1) |
Pfam | Protein kinase domain (PF00069.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |