Id Trinity | FTRINITY_DN58754_c0_g2_i6 |
---|---|
Name Transcript | Ll_transcript_33921 |
Sequence | CGAGTGACATGGGAGCAGCTACATTTCGTCAAACTGGAACAAACTGGGCAGTTATGACTAGTGGTCACTTCTTGGATAGTGGTCGCTCAGACTACTATAA ATGGTCTAATACAACTAAGCTTGCTATGGACAATGCTGAACTATACATGGATGCACGTGTTTCTCCCAATTCTCTGACTTATTATGGATTTTGCATGGGA AATGGAAACTACACAGTGAATCTCCATTTTGCAGAAATCATGTTCACAGCTGATAAAACATATAGCAGTCTTGGAAGGCGTGTATTTGACATCTACATCC AGAGAAAGTTGGTAGTGAAGGATTTCAATATTGCAAAGGAAGCAGGGGGTTTTGATAAGGCAATCATACAAAATTTCAC BLAST |
Tissue | flowers |
Gene name | LI_gene_79799; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_33921
Blastp | Probable LRR receptor-like serine/threonine-protein kinase At1g07650 from Arabidopsis with 54.31% of identity |
---|---|
Blastx | Probable LRR receptor-like serine/threonine-protein kinase At1g07650 from Arabidopsis with 54.31% of identity |
Eggnog | leucine Rich Repeat(COG4886) |
Kegg | Link to kegg annotations (AT1G07650) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449222.1) |
Pfam | Di-glucose binding within endoplasmic reticulum (PF11721.7) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |