Id Trinity | FTRINITY_DN58768_c2_g3_i6 |
---|---|
Name Transcript | Ll_transcript_35112 |
Sequence | GAGACACTTTCTTGTGCGATCTCGGTGGTGATAGAACGACTCTGATCTTCAATGGATGAGCCTCAAGATGATGATGGAACAGAAAGTATAAAGGGTGCTG GCTGATGGTCATATCCCATAGTGATGCTTCAAGCTACAACATACAAATTTAATGTTGGTGACAAACATGGGTGGGTGGTTAAGCCAAAAGAAAGCCGCAA TACGTGGGCTGAAAGAACCAGGCTTCAAGTCAATGACGCTCTATATTTCGAGTTCCATGGAAAGCATGATTCAGTGCTGGTGGTATATAAAGAAGCCTAC TATAAATGCAAATTAAAGAACCCAATCCACAAATTGAGCTATGGCCATTCAGAGTTCAAATTGAATAGACCTGATCCATTAAGCTCATCGTCGCTGTCTT GGCTTTGCCCCACCACAAACATCAATCCCATGCACCTCACCATGCACTTAATATATA BLAST |
Tissue | flowers |
Gene name | LI_gene_79929; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_35112
Blastp | Early nodulin-like protein 2 from Arabidopsis with 43.04% of identity |
---|---|
Blastx | Early nodulin-like protein 2 from Arabidopsis with 44% of identity |
Eggnog | Plastocyanin-like domain(ENOG411137T) |
Kegg | Link to kegg annotations (AT4G27520) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019432170.1) |
Pfam | Plastocyanin-like domain (PF02298.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |