Ll_transcript_50421

• Id Trinity: FTRINITY_DN58815_c2_g1_i1
• Name Transcript: Ll_transcript_50421
• Sequence: CTTAGGCATGGTTAAAATACTTGTTGGACTACCCCTCTCATTGCCAATTAGTTTTGAGATGATACCTTGACAGTGTCAACTAAAATGCATATGATAGTTT TCAGAGACTTTTGGGTGAACTAAAGGTTTCAATTTTCTGAATACTACTAACTAGTCTTCATATGCTAATTTTAAGCTTTTATGAATATCATGTTTTGTAA TCTTTAATTTCCAAATCCAGTGATGAGAATTTTGATGTTACTCGAGCACAAATGATTCTTGATGAAGACCATTATGGATTAACGGATGTGAAGGATAGGA TATTGGAATTCATAGCTGTTGGGAAATTAAG
• Tissue: flowers
• Gene name: LI_gene_80352;
• Additional information: -

Expression of Ll_transcript_50421

FPKM

• FPAB: 2.4
• FPNAB: 0.4
• LF1: 0.2
• LF2: 0.2
• LF3: 0.2
• LF4: 0
• UF1: 1.2
• UF2: 0.2
• UF3: 0.6
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_50421

• Blastp: -
• Blastx: Lon protease homolog 1, mitochondrial from Arabidopsis with 55.07% of identity
• Eggnog: ATP-dependent serine protease that mediates the selective degradation of mutant and abnormal proteins as well as certain short-lived regulatory proteins. Required for cellular homeostasis and for survival from DNA damage and developmental changes induced by stress. Degrades polypeptides processively to yield small peptide fragments that are 5 to 10 amino acids long. Binds to DNA in a double-stranded, site-specific manner (By similarity)(COG0466)
• Kegg: Link to kegg annotations (AT5G26860)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019452267.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;