| Id Trinity | FTRINITY_DN58860_c0_g1_i2 |
|---|---|
| Name Transcript | Ll_transcript_50606 |
| Sequence | ATTTTAATCAAAACCATTAAGATGACTCTCGTGTCACTCGTAGAGATATCTGTTTGAGCTGGCCTGCAATATGCTATGCGAAATTCAGGTAGTTGCCAAC ATTCCCTTCAATATCAGCACAGATGTGATCAAACTACTACTTCCAATGGGTGACATTTTCTCAGAGGTCGTTCTACTTCTCCAGGTTAGAATAGACATCT CTTTCGTGTATATCATGTCTTGTTTACTTTAAATGACAGTATTTCTTTTTCTAATTTACCCGATCTATAGTGTTTCCATCTCTACCTTCCAGTCCCGTGC CCACACCCTTTACCTGATCCAAAGGTCAAGCATATCCCATCTTCATTTTGATCAATATTGCTATCATGGAGCACA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_80710; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_50606
| Blastp | - |
|---|---|
| Blastx | Ribosomal RNA small subunit methyltransferase, chloroplastic from Arabidopsis with 84.85% of identity |
| Eggnog | Specifically dimethylates two adjacent adenosines (A1518 and A1519) in the loop of a conserved hairpin near the 3'-end of 16S rRNA in the 30S particle. May play a critical role in biogenesis of 30S subunits (By similarity)(COG0030) |
| Kegg | Link to kegg annotations (AT1G01860) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020219349.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |