Id Trinity | FTRINITY_DN58903_c0_g2_i6 |
---|---|
Name Transcript | Ll_transcript_38978 |
Sequence | GTTATTGTTTAATGAATTTTTTTGCACATGGCTGTTGCTCACAAGGATATTAAAATATATCAACAGCAGCGAACTTGCAAGGACACTGAAATTGATGCTG GGCTTGTTGGCCATATTCATCTAGATGAGACTATGTTAAAGAAGCTAAAGATCAATATGGATGATGTTTTGCAAAGATGCCAGGAAAGACTTAATTCCTT TAATCGGAAAAAGAAAGTAAATCAAATTTTTAAGAGGATTGAACTGGATTCCAGTGAGTCTTGCTATTGTACACATCCTTCTGCACCGTGTGTCAAGTTC CTCTGGCCAGATGGTGATCATAGTGATTTGGACAAAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_81048; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_38978
Blastp | DNA-directed RNA polymerase V subunit 1 from Arabidopsis with 36.27% of identity |
---|---|
Blastx | DNA-directed RNA polymerase V subunit 1 from Arabidopsis with 36.27% of identity |
Eggnog | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates (By similarity)(COG0086) |
Kegg | Link to kegg annotations (AT2G40030) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449375.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |