Id Trinity | FTRINITY_DN58927_c0_g1_i5 |
---|---|
Name Transcript | Ll_transcript_37849 |
Sequence | CCTTGGGACTGATAAGGTGAATTGGGCTCTTTCCATCGGAAGATTTGTTGTTCATCCTGGCTGGTATGGACCTGTTCAATTTTATATATGCTTGTCTCTC CCCGTTTTTTTTATCTGATTATTTTTCGATGAATTCTTTTATCTGGATTTAACTTGTGCTGGATCTCTCCCCCTCCCTTTCTTATAAAAAAACAGGGTGG AAGCATCAGCATTGCTTTATAGGAGGGCGAATGAACAAGATTTTGCAATAAAACCATAAAAATGACCAACAACCTAATTCTCTTTGGAAAACTAAAATAT GTGAAATCTAAAT BLAST |
Tissue | flowers |
Gene name | LI_gene_81276; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_37849
Blastp | - |
---|---|
Blastx | RNA polymerase II C-terminal domain phosphatase-like 3 from Arabidopsis with 38.82% of identity |
Eggnog | CTD (Carboxy-terminal domain, RNA polymerase II, polypeptide A)(COG5190) |
Kegg | Link to kegg annotations (AT2G33540) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020218578.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |