| Id Trinity | FTRINITY_DN58931_c2_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_38369 |
| Sequence | CTCAAGCTTGGAGAGATCGTCACAACTATTCCCACAATCGGGTTCAATGTGGAGACTGTGGAATACAAGAACATTAGCTTCACTGTCTGGGATGTTGGTG GCCAGGACAAGATTCGTCCCTTGTGGAGGCACTACTTCCAGAATACTCAGGGTCTTATTTTTGTCGTTGATAGCAATGACAGGGACAGAGTTGTTGAGGC CAGAGATGAGTTGCACAGGATGTTGCATGAGGATGAACTGAGAGATGCTGTATTGCTTGTGTTTGCCAACAAACAAGATCTTCCTAACGCAATGAATGCT G BLAST |
| Tissue | flowers |
| Gene name | LI_gene_81307; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_38369
| Blastp | ADP-ribosylation factor from Vigna with 99% of identity |
|---|---|
| Blastx | ADP-ribosylation factor from Vigna with 99% of identity |
| Eggnog | - |
| Kegg | - |
| CantataDB | Link to cantataDB annotations (CNT0000094) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014513266.1) |
| Pfam | ADP-ribosylation factor family (PF00025.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |