Id Trinity | FTRINITY_DN58953_c0_g1_i6 |
---|---|
Name Transcript | Ll_transcript_37034 |
Sequence | CTTTTTCTCTTCACTTTCATCCCTTTGGTTATTCACATTGTTCCTTTACACAAGTTTTTTGCTAAAAAGGGGGAAGAGGGGTTTGAGTTTGTAGACAACA ATGGCCATGGCTAACAAGTTTCTTCTTGTTTTGTTTTTTACCCTTGTTGCCATTTCCATGCTTCAAACATTGGTTATGGCATCTCATGGTCATGGAGGCC ACCACTATAATAACAAGAGAAAATATGGTCCTGGAAGTCTCCAAAGCTACCAATGCCCTTCACAATGCTCAAGAAGGTGTAGCCAAACCCAGTACCACAA GCCATGCATGTTTTTCTGTCAGAAATGTTGTAGGAAGTGCTTATGTGTGCCTCCAGGGTATTATGGTAATAAAGCTGTGTGCCCTTGCTACAACAACTGG AAGACCCAACAAGGAGGTCCCAAGTGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_81496; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_37034
Blastp | Gibberellin-regulated protein 4 from Arabidopsis with 62.62% of identity |
---|---|
Blastx | Gibberellin-regulated protein 4 from Arabidopsis with 62.62% of identity |
Eggnog | Gibberellin-regulated protein(ENOG410YQ6U) |
Kegg | Link to kegg annotations (AT5G15230) |
CantataDB | Link to cantataDB annotations (CNT0002883) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019442661.1) |
Pfam | Gibberellin regulated protein (PF02704.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |