Id Trinity | FTRINITY_DN58978_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_37941 |
Sequence | CTCAGAGCACTCTCAAGCTGTGACTGTAATCGCAGCTTTTCCTGTTTTAACAATGAAACTTCTGTTTCCGCAATTTCTTTCGAACGTCGAAGATAATTAA TCACATTCTGAAGACTGGCATCACCAAGTAAATCAGCACGACTACTTCCAGATGAAACACCGGCATAGTTACGTTCCTTCTCAGCCCACCGAATGTGCAA AGCTTCAAGTTGGCTATGCAGTATTTTATTCTGTTCATTGATTTCATCGTATTTCGTTTCAGCATCACTCCTAGACTTCTCCAGTGCTACCTTCTCCTCT TTCCACTTAGCCTTTAGTTCACTATTTTCAATTTTCTGAGTATCAGCTATCTTACGTAATTCAGATACCTCCT BLAST |
Tissue | flowers |
Gene name | LI_gene_81758; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_37941
Blastp | Nuclear-pore anchor from Arabidopsis with 64.23% of identity |
---|---|
Blastx | Nuclear-pore anchor from Arabidopsis with 64.23% of identity |
Eggnog | translocated promoter region, nuclear basket protein(ENOG410XSA1) |
Kegg | Link to kegg annotations (AT1G79280) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019455453.1) |
Pfam | TPR/MLP1/MLP2-like protein (PF07926.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |