Id Trinity | FTRINITY_DN59018_c2_g1_i5 |
---|---|
Name Transcript | Ll_transcript_146703 |
Sequence | TGTCAATAAAGAATTTCATTTGTGTCAGTGAAAAGGTCCAGTGGGCTCAATGTGAAAATTGTCTTAAGTGGCGCAAATTGCCAGCAAGTGCGCTTCTTCC ATCAAAATGGACGTGTTCTGATAATTCATGGGACCCAGAAAGATCTTCTTGTTCGGCTGCACAAGAGCTAACAGCAGAGCAGCTGGAGAATATGCTACCC CCTTGTAGTTCAG BLAST |
Tissue | flowers |
Gene name | LI_gene_82125; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_146703
Blastp | - |
---|---|
Blastx | B3 domain-containing protein Os07g0563300 from Oryza sativa with 68.97% of identity |
Eggnog | B3 domain-containing protein(ENOG410Z235) |
Kegg | Link to kegg annotations (4343608) |
CantataDB | Link to cantataDB annotations (CNT0000445) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_006597399.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |