Ll_transcript_146502

• Id Trinity: FTRINITY_DN59019_c0_g1_i16
• Name Transcript: Ll_transcript_146502
• Sequence: CTCATAATATTTTGTTTCTTTCAACTATCCCTTTTCAAGCAATTTTATGGATCTGTGACAAAATCAGATTATGTGACATTACGTCTTGGCTTTATTATGA CCCATTGCAGGGGAAATCCTAAGTTTAATTTTCATAAGTACATGATCAGTGCCCTCGAAGATGATTTCAGACAATATTTTGGGATAAGATATACGGTTGG TTGAGTTGA
• Tissue: flowers
• Gene name: LI_gene_82130;
• Additional information: -

Expression of Ll_transcript_146502

FPKM

• FPAB: 19.8
• FPNAB: 19.1
• LF1: 20.1
• LF2: 11.7
• LF3: 14.5
• LF4: 13.2
• UF1: 8.5
• UF2: 15.2
• UF3: 5
• UF4: 18.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_146502

• Blastp: -
• Blastx: MLO-like protein 1 from Arabidopsis with 78.18% of identity
• Eggnog: May be involved in modulation of pathogen defense and leaf cell death (By similarity)(ENOG410ZUVB)
• Kegg: Link to kegg annotations (AT4G02600)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019438246.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;