Id Trinity | FTRINITY_DN59027_c0_g4_i1 |
---|---|
Name Transcript | Ll_transcript_144765 |
Sequence | CTCACTTATCGCCGATCTTCAGCATGTGAAGCCAACCCATGTTTTTAATGCTGCAGGAGTTACTGGCAGACCCAATGTTGATTGGTGTGAATCTCATAAA ACAGAAACCATCCGCACCAATGTCGCCGGAACTCTAACATTAGCTGATGTCTGCAGAGAGCAAGGGATCTTGGTGATCAATTATGCTACTGGATGCATAT TTGAGTATGATGCAGCACATCCAGAGGGCTCTGGAATTGGATATAAGGAGGAAGACAAACCCAATTTCATTGGCTCTTTCTATTCCCAAACTAAAGCTAT GGTTGAGGAGCTCTTGAGAGAATATGATAATGTATGCACCCTCAGGGTTCGCATGCCGATTTCATCCGACCTGAACAACCCGCGCAACTTCATTACAAAG ATTTCGCGATACAACAAGGTAGTTAACATCCCAAACAGCATGACTATTTTGGAT BLAST |
Tissue | flowers |
Gene name | LI_gene_82203; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_144765
Blastp | Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM3 from Arabidopsis with 88.74% of identity |
---|---|
Blastx | Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM3 from Arabidopsis with 88.74% of identity |
Eggnog | dTDP-glucose 4-6-dehydratase(COG1088) |
Kegg | Link to kegg annotations (AT3G14790) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453523.1) |
Pfam | RmlD substrate binding domain (PF04321.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |