Id Trinity | FTRINITY_DN59051_c1_g2_i17 |
---|---|
Name Transcript | Ll_transcript_145501 |
Sequence | GCTGGGCGTTGGTGGTCCTAGTGGCGGTAAGAGTGGTAGTGGCATATTCAATATAGGAAAAGCCCATGTTACCAAAGTAGACAAAAATGCCAAAAACAAG GTTTTTTTCAAAGATGTTGCTGGCTGTGATGAGGCAAAGCAAGAAATTATGGAGTTTGTCCACTTCCTCAAGAGCCCAAAGAAATATGAAGAACTTGGTG CAAAAATTCCAAAAGGTGCACTTTTGGTGGGTCCTCCTGGCACAGGAAAAACCCTTTTAGCAAAAGCAACTGCTGGGGAATCTGGTGTGCCATTTTTTTC TATATCTGGTTCGGATTTCATGGAAATGGTTGTTGGTGTTGGACCGTCTAGGGTGAGAAACTTGTTTCAGGA BLAST |
Tissue | flowers |
Gene name | LI_gene_82428; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_145501
Blastp | ATP-dependent zinc metalloprotease FTSH 8, mitochondrial from Oryza sativa with 94.5% of identity |
---|---|
Blastx | ATP-dependent zinc metalloprotease FTSH 8, mitochondrial from Oryza sativa with 94.5% of identity |
Eggnog | Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465) |
Kegg | Link to kegg annotations (4339002) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020992952.1) |
Pfam | ATPase family associated with various cellular activities (AAA) (PF00004.28) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |