Id Trinity | FTRINITY_DN59069_c5_g3_i1 |
---|---|
Name Transcript | Ll_transcript_145130 |
Sequence | ACGGTTCAAACACAATCATTTTAGCTAATATGGCTCTTCTCCAACTTGCTTCACTGTCAATTAGTCTCACCAACGTTCTTCCTCTTCAGAGAAAGTCAAC ACTTATAGCAACCAAGCCATTTCAATGCATGGCATCAAACAATTCTGTTCCTAATATTCAATCAATTTCACGTAGATCTACAAAATTTGAACCTTCAATT TGGAGTTATGATTATATTCAGTCATTGAGTAGTGAATATATGGATGAATCATACAAAGAGCAAAGTAGAGTGCTCAGGGAAGAAGTTAGGATGATGCTTT CCAAAGTGGTAAATCATCTTGATCAACTTGCCCTGATTGATGTTCTACACAGGCTTGGAGTGGCTTATCATTT BLAST |
Tissue | flowers |
Gene name | LI_gene_82548; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_145130
Blastp | Myrcene synthase, chloroplastic from Quercus with 43.55% of identity |
---|---|
Blastx | Myrcene synthase, chloroplastic from Quercus with 52.87% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453842.1) |
Pfam | Terpene synthase, N-terminal domain (PF01397.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |