Id Trinity | FTRINITY_DN59104_c2_g1_i18 |
---|---|
Name Transcript | Ll_transcript_254639 |
Sequence | GACAGGGCTCTTACACCTTATGAATTTGTTGAAAGTATGAAGAAGAAGGGCATTCGTGTGCCAGGAATCGGGCACAGGATCAAGAATAGGGACAACAAAG ACAAGAGAGTTGAGCTGCTACAGAAGTTTGCACGCGCACATTTTCCTTCTGTGAAATATATGGAATATGCAGTCGAAGTTGAAACCTACACTCTCACGAA GGCAAATAATGTAGTTCTTAACGTAGATGGTGCAATTGGGTCCCTTTTCTTGGATCTTCTTGCAGGTAGTGGAATGTTTTCCAAACAAGAGATTGACGAA ATTGTGGAGATTGGCTATCT BLAST |
Tissue | flowers |
Gene name | LI_gene_82839; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_254639
Blastp | ATP-citrate synthase beta chain protein 2 from Arabidopsis with 89.62% of identity |
---|---|
Blastx | ATP-citrate synthase beta chain protein 2 from Arabidopsis with 89.62% of identity |
Eggnog | Succinyl-CoA ligase ADP-forming subunit alpha(COG0074) |
Kegg | Link to kegg annotations (AT5G49460) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014491600.1) |
Pfam | Citrate synthase, C-terminal domain (PF00285.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |