Id Trinity | FTRINITY_DN59138_c1_g1_i27 |
---|---|
Name Transcript | Ll_transcript_256163 |
Sequence | CAAAACGCTTCTAGCTAGGGCCGTGGCTAATAGGACTGATGCTTGTTTTATAAGGGTTATTGGAAGTGAGCTAGTTCAGAAGTATGTTGGTGAGGGGGCT CGGATGGTTCGTGAGTTATTCCAGATGGCTCGTTCAAAGAAGGCATGCATTGTGTTTTTTGATGAAGTTGATGCTATAGGAGGTGCACGATTTGATGATG GTGTTGGTGGTGACAACGAGGTTCAGCGCACTATGCTTGAAATTGTGAATCAGCTTGATGGGTTTGATGCTCGTGGAAACATCAAAGTTCTGATGGCTAC TAACAGGCCTGACACTCTTGATCCAGCATTACTACGGCCTGGACGATTGGATCGTAAAGTTGAATT BLAST |
Tissue | flowers |
Gene name | LI_gene_83151; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_256163
Blastp | 26S proteasome regulatory subunit 7 from Prunus with 100% of identity |
---|---|
Blastx | 26S proteasome regulatory subunit 7 from Prunus with 100% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (18783658) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014626850.1) |
Pfam | ATPase family associated with various cellular activities (AAA) (PF00004.28) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |