| Id Trinity | FTRINITY_DN59202_c0_g1_i2 |
|---|---|
| Name Transcript | Ll_transcript_13680 |
| Sequence | CGTTGTTGGGAAATTTGTTGAATTTTATGGTGATGGTATGGGTAAATTATCTTTAGCCGACAGGGCGACTATTGCTAACATGTCTCCTGAATATGGTGCT ACTATGGGCTTCTTCCCTGTGGATCATGTCACATTACAATATCTCAAGTTAACTGGAAGAAGTGATGAACCTGTGGCCATGATAGAGTCCTATCTCAGGG CAAATAACATGTTTGTTGACTATAATGAGCCGCAACAAGACAGAGTTTATTCATCATATCTTGAATTAAACCTGTCTGATGTTGAACCATGCATCTCAGG ACCAAAGAGACCTCATGATCGGGTGCCTTTGAAAGAAATGAAGGCTGACTGGCATTCTTGTCTTGATAGCAAAGTTGGGTTTAAGGGATTTGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_83777; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_13680
| Blastp | Aconitate hydratase 3, mitochondrial from Arabidopsis with 94.62% of identity |
|---|---|
| Blastx | Aconitate hydratase 3, mitochondrial from Arabidopsis with 94.62% of identity |
| Eggnog | aconitate hydratase(COG1048) |
| Kegg | Link to kegg annotations (AT2G05710) |
| CantataDB | Link to cantataDB annotations (CNT0000366) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019413160.1) |
| Pfam | Aconitase family (aconitate hydratase) (PF00330.19) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |