Ll_transcript_14126

• Id Trinity: FTRINITY_DN59216_c0_g2_i2
• Name Transcript: Ll_transcript_14126
• Sequence: AAGACCTTTAAATAAGAAGGAGCTCACCAAGAAGGAGGATGATGTTGTAACTGTATATGACAATTCATATCTGGCAGTCCATGAACCCAAACTAAAGGTT GATTTGACAGCTTATGTAGAGAAGCATGAGTTTTGTTTTGATGCTGTTCTTGATGAGCATGTTGCCAATGATGAAGTATATCAAGCTACAGTAGAACCAA TTATTCCTACAATCTTTGAGCGAACCAAAGCTACCTGTTTTGCTTATGGTCAGACAGGAAGTGGCAAAACATTTACAATGCAACCATTACCACTCAGAGC GGCACAAGACCTTATTCGACAGTTGAGTCGTCCAGTTTATCGAAATCAGCGATTTAAATTGTGGCTTAGCTACTTTGAGATATAT
• Tissue: flowers
• Gene name: LI_gene_83907;
• Additional information: details;

Expression of Ll_transcript_14126

FPKM

• FPAB: 11.3
• FPNAB: 17.5
• LF1: 14.7
• LF2: 13.7
• LF3: 8.9
• LF4: 7.9
• UF1: 10.9
• UF2: 13.9
• UF3: 12.8
• UF4: 9

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_14126

• Blastp: Kinesin-like protein KIN-13A from Arabidopsis with 82.03% of identity
• Blastx: Kinesin-like protein KIN-13A from Arabidopsis with 82.03% of identity
• Eggnog: Kinesin family member(COG5059)
• Kegg: Link to kegg annotations (AT3G16630)
• CantataDB: Link to cantataDB annotations (CNT0000890)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019463571.1)
• Pfam: Kinesin motor domain (PF00225.22)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;