Id Trinity | FTRINITY_DN59224_c1_g2_i9 |
---|---|
Name Transcript | Ll_transcript_15896 |
Sequence | ATTTTCAATGACAAGGAGTTTGAATTATTGATAAGTGGACTTCCTGATATTGATTTGGATGACTTGAGAGCAAATACAGAATATTCTGATTATAGTGTTG CATCACCAGTTATCCAATGGTTTTGGAAGGTTGTTCAAGGTTTCAGCAGAGAAGATAAGGCTCGGTTATTGCAGTTTGTGACCGGCACATCTAAGGTGCC TTTGGAAGGTTTTAGTGCTCTTCAAGGAATTTCAGGCTCCCAGAAGTTTCAGATACACAAGGCATATGGTAGTCCTGATCATTTGCCTTCTGCTCATACT TGTTTCAACCAATTAGATTTGCCAGAGTATCC BLAST |
Tissue | flowers |
Gene name | LI_gene_83989; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_15896
Blastp | E3 ubiquitin-protein ligase UPL2 from Arabidopsis with 80.91% of identity |
---|---|
Blastx | E3 ubiquitin-protein ligase UPL2 from Arabidopsis with 80.91% of identity |
Eggnog | ubiquitin protein ligase(COG5021) |
Kegg | Link to kegg annotations (AT1G70320) |
CantataDB | Link to cantataDB annotations (CNT0001834) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020222235.1) |
Pfam | HECT-domain (ubiquitin-transferase) (PF00632.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |