Ll_transcript_16099

• Id Trinity: FTRINITY_DN59233_c1_g1_i2
• Name Transcript: Ll_transcript_16099
• Sequence: TCTCCTTCCATCACCAAACAAAGATGAAACTTTGATAGATGTTGCAAATCAATGTTTGCATGAACTAATGTCGAGATCTTTTCTTGAGGAATTTGTCAAC TTTGGCACTTCATATTATTTTCAAGTACATGATTTGAAGAATGATCTTGCTCGGTCTATTGCAAAAGATGAGTGCCACATGGTAAATTCCAACATCCAAA ATGTACCTGAAAATGTTCAACATCTATCTTTTGCTGAAGATGATTTGCTTGGTAATTCTTTCACCTCAAAGTCTATTGTTGTAAGAACCATACTATTT
• Tissue: flowers
• Gene name: LI_gene_84111;
• Additional information: details;

Expression of Ll_transcript_16099

FPKM

• FPAB: 0
• FPNAB: 0.8
• LF1: 0
• LF2: 0.2
• LF3: 0.3
• LF4: 0
• UF1: 0
• UF2: 0.8
• UF3: 0.5
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_16099

• Blastp: Putative disease resistance protein At3g14460 from Arabidopsis with 35.44% of identity
• Blastx: Putative disease resistance protein At3g14460 from Arabidopsis with 35.44% of identity
• Eggnog: leucine Rich Repeat(COG4886)
• Kegg: Link to kegg annotations (AT3G14460)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019425580.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;