Id Trinity | FTRINITY_DN59236_c0_g6_i3 |
---|---|
Name Transcript | Ll_transcript_15576 |
Sequence | CTTATTGCAGGCCTTGAGTACAAGCCCAAATCCTCCTACAGACTAGGAAGTGGTGATGCTTCTCGAGAATTTTGGTTTGAAACACCTCCCAAAGTTGAGC CAGATGTACCTTACAAATTTGGGATCATTGGTGATTTGGGCCAAACATTTAATTCTCTATCAACTCTTGAGCATTACCTGCAGAGTGGAGCACAGACTGT GTTATTTGTTGGAGATCTTTCTTATGCTGATAGGTACAAGTACAATGATGTTGGTTTGCGATGGGACACATGGGGCCGGTTTGCCGAAAGGAGTACAGCA TATCAACCATGGATTTGGTCTGTTGGACATCACGAAGTAGATTACATGCCCTACATGGGGGAAGATACTCCTTTCAAGAACTTCCTTAACCGATACACTA CTCCTTATTTGGCCTCCCAAAGCAGCAGTCCACTCTGGTATGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_84144; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_15576
Blastp | Bifunctional purple acid phosphatase 26 from Arabidopsis with 76.35% of identity |
---|---|
Blastx | Bifunctional purple acid phosphatase 26 from Arabidopsis with 76.35% of identity |
Eggnog | Hydrolyzes cAMP to 5'-AMP. Plays an important regulatory role in modulating the intracellular concentration of cAMP, thereby influencing cAMP-dependent processes (By similarity)(COG1409) |
Kegg | Link to kegg annotations (AT5G34850) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440736.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |