| Id Trinity | FTRINITY_DN59238_c2_g11_i2 |
|---|---|
| Name Transcript | Ll_transcript_15546 |
| Sequence | CTTGATATGACAAGCACCCTTTTGGGTGTTGGATTGCATGATGGATGCAGTACAATGTTCGATGATAAGGTTTCTCTTCTTCTTTATGCCTTACCGAAGG CTTTGCAAGCAGCACCCAACAGGCTAATGACTAATAATGTTTACATAGCTCTATTGGCTGCCTCGATCAATGCCTCTTCAATAGAGGATGAGTTGAACTT TTATGATTCTGGTCATCTCTTTAAGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_84159; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_15546
| Blastp | - |
|---|---|
| Blastx | BEACH domain-containing protein C2 from Arabidopsis with 72.97% of identity |
| Eggnog | beige BEACH domain containing protein(ENOG410XNQC) |
| Kegg | Link to kegg annotations (AT2G45540) |
| CantataDB | Link to cantataDB annotations (CNT0001256) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019431477.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |