Ll_transcript_15875

• Id Trinity: FTRINITY_DN59247_c1_g1_i14
• Name Transcript: Ll_transcript_15875
• Sequence: ACATCTTATCCTACTTCCAACTTGTATTTTATTCAAGTTTGGAAAATTCAATGTGTACTCCTTGATACTTTAAGAGATGAAGATGAAGTTTTGAGGAGCA TGACTAATAAGATGGTTAAGAAGTTTGAGAAATATTGGGATGATTATAGTATTGTGCTGGCTATGGGGGCAATTCTTGACCCAAGAGTGAAGTTGGAGAC ATTGAATTATTGTTTTGAAAGAGTTGATGATTCTACTTTTGAAACAAAGTTGCAATTAGTTAAGAGAAAGTTGTACATGCTATTTGAACAATACCGT
• Tissue: flowers
• Gene name: LI_gene_84243;
• Additional information: details;

Expression of Ll_transcript_15875

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0
• UF2: 0.3
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_15875

• Blastp: Zinc finger BED domain-containing protein RICESLEEPER 3 from Oryza sativa with 30.53% of identity
• Blastx: Zinc finger BED domain-containing protein RICESLEEPER 3 from Oryza sativa with 30.53% of identity
• Eggnog: transposon protein(ENOG410Y37V)
• Kegg: Link to kegg annotations (4339741)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019414580.1)
• Pfam: Domain of unknown function (DUF4413) (PF14372.5)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;