Ll_transcript_15470

• Id Trinity: FTRINITY_DN59248_c3_g1_i11
• Name Transcript: Ll_transcript_15470
• Sequence: AGTGTAGTTGTTCTTCTTTGTCGTGAACCTTGCTTGAGTGTCAATGCATTGAAGGACATGAATTGGGACCTTAGTCAATGGTGTCCCTTGATTGACGATA GGTGCTTCTTGCAGTGGCTCGTCAAGGTTCCATCCGAACAAGAGCAGTTAAGGGCACGCCAAATAAGTGCGCAGCAAATAAATAAGGTGGAAGAGTTGTG GAAGACAAACCCCGATGCTTCTTTTGAGGACCTTGAGAAGCCTGGTGTAGATGATGAACCTCAATCCGTGGCTTTGAAATACGAGGATGCATATCAGTAT CAAAATGTATTTGCACCTCTTATTAAGCTTGAAGCCGATTATGATAAGATGATGAAAGAATCACAAAGCAAGGACAAT
• Tissue: flowers
• Gene name: LI_gene_84250;
• Additional information: details;

Expression of Ll_transcript_15470

FPKM

• FPAB: 3.8
• FPNAB: 1.5
• LF1: 3.4
• LF2: 2.9
• LF3: 3.4
• LF4: 2.6
• UF1: 2.4
• UF2: 3.4
• UF3: 3.4
• UF4: 1.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_15470

• Blastp: Regulator of nonsense transcripts 1 homolog from Arabidopsis with 92.06% of identity
• Blastx: Regulator of nonsense transcripts 1 homolog from Arabidopsis with 92.06% of identity
• Eggnog: Helicase(COG1112)
• Kegg: Link to kegg annotations (AT5G47010)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019421384.1)
• Pfam: RNA helicase (UPF2 interacting domain) (PF09416.9)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;