| Id Trinity | FTRINITY_DN59248_c3_g1_i7 |
|---|---|
| Name Transcript | Ll_transcript_15463 |
| Sequence | AATTCTTGAATGCTACAACTGGGGGTGTCGTAATGTGTTTCTCCTGGGATTTATTTCTGCCAAGACTGAAAGTGTAGTTGTTCTTCTTTGTCGTGAACCT TGCTTGAATGTTAATGCATTGAAGGATATGAATTGGGACCTTAGCCAATGGTGTCCCTTGATTGATGATAGGTGTTTCTTGCAGTGGCTCGTCAAGGTCC CATCTGAACAAGAGCAGTTAAGGGCACGCCACATAAGTGCACAGCAAATAAATAAAGTGGAAGAGTTGTGGAAGACAAATCCGGATGCTTCTTTTGAGGA CCTCGAGAAGCCTGGTGTAGATGATGAACCTCAATCTGTGGCACTGAAATACGAAGATGCATATCAGGTGCATGTTTTGTATGGCTTGCTATTGTTTTAC GTT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_84250; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_15463
| Blastp | Regulator of nonsense transcripts 1 homolog from Arabidopsis with 85.5% of identity |
|---|---|
| Blastx | Regulator of nonsense transcripts 1 homolog from Arabidopsis with 85.5% of identity |
| Eggnog | Helicase(COG1112) |
| Kegg | Link to kegg annotations (AT5G47010) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019445009.1) |
| Pfam | RNA helicase (UPF2 interacting domain) (PF09416.9) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |