Id Trinity | FTRINITY_DN59248_c3_g1_i7 |
---|---|
Name Transcript | Ll_transcript_15463 |
Sequence | AATTCTTGAATGCTACAACTGGGGGTGTCGTAATGTGTTTCTCCTGGGATTTATTTCTGCCAAGACTGAAAGTGTAGTTGTTCTTCTTTGTCGTGAACCT TGCTTGAATGTTAATGCATTGAAGGATATGAATTGGGACCTTAGCCAATGGTGTCCCTTGATTGATGATAGGTGTTTCTTGCAGTGGCTCGTCAAGGTCC CATCTGAACAAGAGCAGTTAAGGGCACGCCACATAAGTGCACAGCAAATAAATAAAGTGGAAGAGTTGTGGAAGACAAATCCGGATGCTTCTTTTGAGGA CCTCGAGAAGCCTGGTGTAGATGATGAACCTCAATCTGTGGCACTGAAATACGAAGATGCATATCAGGTGCATGTTTTGTATGGCTTGCTATTGTTTTAC GTT BLAST |
Tissue | flowers |
Gene name | LI_gene_84250; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_15463
Blastp | Regulator of nonsense transcripts 1 homolog from Arabidopsis with 85.5% of identity |
---|---|
Blastx | Regulator of nonsense transcripts 1 homolog from Arabidopsis with 85.5% of identity |
Eggnog | Helicase(COG1112) |
Kegg | Link to kegg annotations (AT5G47010) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019445009.1) |
Pfam | RNA helicase (UPF2 interacting domain) (PF09416.9) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |