| Id Trinity | FTRINITY_DN59276_c1_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_14103 |
| Sequence | GTGAAAAAGAAGGATGGAGGTTGGAGATTTTGTGTAGATTACAGAGCCCTCAACAAAGTAACCATCCCTAACAAATTCCCTATCCCAATTATTGAGGAAT TGTTGGATGAACTTGGGGGAGCTAAGATGTTTTCTAAGTTGGACTTGAAATCTGGTTATCACCAGATCCGAATGAGGGAGCAAGTTGTAGAGAAGACTGC TTT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_84583; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_14103
| Blastp | - |
|---|---|
| Blastx | Transposon Ty3-I Gag-Pol polyprotein from Saccharomyces with 56.72% of identity |
| Eggnog | - |
| Kegg | Link to kegg annotations (YIL082W-A) |
| CantataDB | Link to cantataDB annotations (CNT0002695) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019459981.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |