Id Trinity | FTRINITY_DN59285_c3_g1_i10 |
---|---|
Name Transcript | Ll_transcript_14194 |
Sequence | ATCGAAATCCTCACCAGGTTCATGGTGTTGTTCTAGATAGGAATGGAAAAACAGCATCAACTTTGTTTGGGAAATGGGATGAGAGCATGCATTATGTTAA TGGAGACTACAGTGGAAAGGGGAAAAGTCACGAATCATTGTCAGAAGCCCATATACTCTGGAAGAGGAGTAAGCCTCCTAAGGATCCTACTAGATATAAC TTCACTCGCTTTGCCATCACATTAAATGAACTTACCCCTGGATTGAAGGAAAAGTTACCACCTACAGATTCCAGGTTAAGACCAGACCAAAGGTATTTGG AAAATGGGGAGTTTGAGATGGCA BLAST |
Tissue | flowers |
Gene name | LI_gene_84663; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_14194
Blastp | Oxysterol-binding protein-related protein 1C from Arabidopsis with 76.64% of identity |
---|---|
Blastx | Oxysterol-binding protein-related protein 1C from Arabidopsis with 76.64% of identity |
Eggnog | Oxysterol-binding protein(ENOG410XP9E) |
Kegg | Link to kegg annotations (AT4G08180) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019433164.1) |
Pfam | Oxysterol-binding protein (PF01237.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |