Id Trinity | FTRINITY_DN59323_c2_g1_i13 |
---|---|
Name Transcript | Ll_transcript_115598 |
Sequence | CTGAATCTAAAAAGACATTGTCCTCAACTTCCTTCCAAGATGATTCAGGAATTGACATATGCACATTCCTGCAATTATTGGTTGCTCATAAAAGAATTAT ATTCTGTCCCAGCAATACTGATACAGATCTTAATTGCTGTCTATGCATGAATTTGATATATCTTCTCTATGATACAAGACAAAATGTACAGCATATTGCC ATTGATGTGTTCAAGTATCTTCTCGTACATAGGAGGGCTGCATTGGAAGACTTGCTTGTATCTAAACCTAATCAGGGGCAGCTACTTGATGTGCTTCATG GTGGTTTTGATAAATTATT BLAST |
Tissue | flowers |
Gene name | LI_gene_85051; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_115598
Blastp | Protein SPIRRIG from Arabidopsis with 72.38% of identity |
---|---|
Blastx | Protein SPIRRIG from Arabidopsis with 72.38% of identity |
Eggnog | beige BEACH domain containing protein(ENOG410XNQC) |
Kegg | Link to kegg annotations (AT1G03060) |
CantataDB | Link to cantataDB annotations (CNT0002534) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019428216.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |