Id Trinity | FTRINITY_DN59374_c6_g3_i8 |
---|---|
Name Transcript | Ll_transcript_114035 |
Sequence | ATTTCCAATGGAAATAAACTCTCTGGAAATTCTGGGGTTGGTGTGCAAGGAAATCTTTATGCTGATCTGAAGGACATCCTTGAGACCTGGAGACTAAGAA CTCCAAATGAATGGGATAATATGTCTGTTTGGTATGATTTGCTGCAGTGGAGAAATGAAATGTATAATCATGTCATAGAGGCTTTTAAAGATTTTGGCTC CACAAACTCAGCACTTCATCATCTTGGCTACCGTGACAAAGCATGGACCGTCAACAGGCTTGCTCACATTGC BLAST |
Tissue | flowers |
Gene name | LI_gene_85522; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_114035
Blastp | - |
---|---|
Blastx | Uncharacterized PI3/PI4-kinase family protein C1F5.11c from Schizosaccharomyces with 33.33% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (SPAC1F5.11c) |
CantataDB | Link to cantataDB annotations (CNT0000204) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019421111.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |