| Id Trinity | FTRINITY_DN61213_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_239605 |
| Sequence | AGCATCTTTCACAAGATGGTACTCCCTCAAGTGCTTGTCAGTGCCCGCCAAGTTCCTGCTCTTCTGAGGAGGAACTTCGGAATCTGCGTACCTGCAGCCC AGAAGGCATCTGATCCAATCCAACAGTTGTTCGTTGACAAAATTAGAGAATACAAGTCCAAAAGCTCTGGTGGTAAAATGGTTGAGGCCACTCCAGAAAT CCAGAAAGAGTTGGCAGCTGAATTGGAACGAGTTCAGAAGACGTATGGATTTGCAGCAGGAGCCAATGTGTCAGACCTGCCCCCCATGAAATTCCAAGAC CCTGACCTGAGGGATGCTGTTTAGATGCCTTTTTCAACTTACGAACATTGGAATATTTGGAAATTGTTCTGTTATGTGACTAATTCGATTGTTGTGACAT TGTCTCCCGTCACAATGTTCTTTGTTGAGG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_87696; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_239605
| Blastp | ATP synthase-coupling factor 6, mitochondrial from Sophophora with 50.51% of identity |
|---|---|
| Blastx | ATP synthase-coupling factor 6, mitochondrial from Sophophora with 50.51% of identity |
| Eggnog | Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain(ENOG41122G1) |
| Kegg | Link to kegg annotations (Dmel_CG4412) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019459620.1) |
| Pfam | Mitochondrial ATP synthase coupling factor 6 (PF05511.10) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |