Ll_transcript_269984

• Id Trinity: FTRINITY_DN77422_c0_g1_i1
• Name Transcript: Ll_transcript_269984
• Sequence: CTAGCTTGAAAGTTCATCAATATAAAAATAAAGAGATAACAGAAATGTCAGTCCATCTAGTAAAATGCAGTCAACAAGATGTCCTTGAAATCATAAAGGT GAAATTAAATTTCACCTAAAGATTTATAGATCAATCACACGTGATAATTTTTGGATCCGGTTCAATAGGAAGTCCCCTTGCTTAATAGTTGCTTGATAAA GAGCATTCTTAGCATCAGGACGGTTAGTTTCAAGAACTCCAGCAACTTTATC
• Tissue: flowers
• Gene name: LI_gene_104231;
• Additional information: -

Expression of Ll_transcript_269984

FPKM

• FPAB: 0
• FPNAB: 0.9
• LF1: 2.4
• LF2: 0.4
• LF3: 1
• LF4: 0
• UF1: 3.3
• UF2: 0
• UF3: 1.1
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_269984

• Blastp: -
• Blastx: 26S proteasome non-ATPase regulatory subunit 6 homolog from Arabidopsis with 100% of identity
• Eggnog: Proteasome (Prosome, macropain) 26S subunit, non-ATPase, 6(COG5187)
• Kegg: Link to kegg annotations (AT4G24820)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004515835.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;