Id Trinity | FTRINITY_DN91684_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_275717 |
Sequence | TATAAGATTTCCTTTCAATGAAGATGGCCAAATGGAAAAGTCTGAGGATTGCACAAATTATGAAAGGATTTTCCATTTCTCCAAGGAGAAGATCGCAAAA ATAAAATCAAAAGCTAATGAAGAAGCCGACACGGACAAAATATCTTCTCTCCAGGCACTATTAACTCACCTTTGGCGCACTACGATCCGTAACCAACAAC TTGACCCAGAAAAAGAGTGCAGCTTTCTTGTAGCAATAGACACTAGAGGGAGAATAGATCCACCATTGCCAGATAGTTATTTTGGAAATGCATTGGTTTT TGATGATATTAGAACG BLAST |
Tissue | flowers |
Gene name | LI_gene_118535; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_275717
Blastp | Protein ENHANCED PSEUDOMONAS SUSCEPTIBILTY 1 from Arabidopsis with 42.11% of identity |
---|---|
Blastx | Uncharacterized acetyltransferase At3g50280 from Arabidopsis with 42.5% of identity |
Eggnog | Transferase family(ENOG411040Y) |
Kegg | Link to kegg annotations (AT5G67160) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019459819.1) |
Pfam | Transferase family (PF02458.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |