Id Trinity | TRINITY_DN10114_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_534367 |
Sequence | GGTCCATAGACTAAACCAACAAATTTTGTCTGCAAAGGATCTCAAATCTAAACTGGAAACATCCTCTACTTTGTTGCTTGATCTGAAAGCTGAGTTATCT GCTTATATGGAATCAAAGTTAAAGCGGGAAGATGACGAAGAAGGAAATTCAAATGGAGATCTAAAGATACCTGAGAAAAAGACACACAATGATATACAAA CAGCAGTGGCATCAGCCAAAAAGGAACTTGAAGAAGTAAAACTTAATATAGAGAAAGCAACTTATGAGGTTAGTTTTTTGAAAGTAGCAGCTACATCATT AAAATCGGAACTTGAACAAGAAAAATCAACTCTTGC BLAST |
Tissue | pods |
Gene name | LI_gene_119033; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_534367
Blastp | Protein WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT 1 from Arabidopsis with 64.86% of identity |
---|---|
Blastx | Protein WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT 1 from Arabidopsis with 64.86% of identity |
Eggnog | Pfam:DUF827(ENOG410YG1U) |
Kegg | Link to kegg annotations (AT2G26570) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019414339.1) |
Pfam | Weak chloroplast movement under blue light (PF05701.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |