Id Trinity | TRINITY_DN11894_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_321968 |
Sequence | AGGATTGCTGGTGAGATCGCCAAGATGGATTTCACAAGTGGCAAGATCATCTTCAACAAATTCAAGTCTGTGGTGTCATACCAGGTGTCGGACCTGCCCC TGTTCAGCTTGGATTCTGTGTCCAAGGCACCAAAAATCACAACTTACGACTCTTTGGATGATGATGTCATCAAGAGCTACATGGAATTTTCTCTGGCCTC TATGCTCTATTACGCCATGAAGGAGGGTGCCTGCTCTGAGCAATCGTCTCGTATGACAGCTATGGACAATGCCAGCAAGAATGCCGGTGAAATGATTGAG AAGCTGACTCTTACATTCAACCGAACTCGCCAGGCCGTCATTACCAGGGAACTTATTGAAATTATTTCTGGTGCCTCAGCTTTGTAAATCAATTTTATTG AACCTTAAAGTAGTGAATGCCTCTACGGCTTCATCAATGCTAGGAGGCAACAAAACTGCCATTGTAAGTGCTCCCAGATTTTATAAAAGGCTCATCTGTA TATCAATATTTTTTTTTTTAACâBLAST |
Tissue | pods |
Gene name | LI_gene_119561; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_321968
Blastp | ATP synthase subunit gamma, mitochondrial from Sophophora with 73.85% of identity |
---|---|
Blastx | ATP synthase subunit gamma, mitochondrial from Sophophora with 73.85% of identity |
Eggnog | Produces ATP from ADP in the presence of a proton gradient across the membrane. The gamma chain is believed to be important in regulating ATPase activity and the flow of protons through the CF(0) complex (By similarity)(COG0224) |
Kegg | Link to kegg annotations (Dmel_CG7610) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014496317.1) |
Pfam | ATP synthase (PF00231.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |