Id Trinity | TRINITY_DN13408_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_458868 |
Sequence | CACAGGTGAGAGCCGTGAGCAGGTTGCCAACTCTGCCTTCGTTGAGCGTGTTAAGAAGCGTGGATTTGAAGTTATCTACATGACTGAGCCCATTGATGAG TACGTCGTACAGCAGCTGAAGGACTTTGATGGCAAGACTCTGGTCTCAGTCACGAAGGAGGGTCTTGAGCTCCCCGAGGACGAGGAAGAAAAGAAGAAAC GTGAGGAGGACAAGGCTAAGTTCGAAAACTTGTGCAAGGTTATGAAGGACATTTTGGACAAGAAGGTTGAAAAAGTTGTAGTCTCAAACAGGTTAGTTGA ATCTCCCTGCTGCATTGTCACCTCCCAGC BLAST |
Tissue | pods |
Gene name | LI_gene_120098; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_458868
Blastp | Heat shock protein HSP 90-beta from Danio with 87.96% of identity |
---|---|
Blastx | Heat shock protein HSP 90-beta from Bos with 87.96% of identity |
Eggnog | Molecular chaperone. Has ATPase activity (By similarity)(COG0326) |
Kegg | Link to kegg annotations (30573) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020220602.1) |
Pfam | Hsp90 protein (PF00183.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |