Id Trinity | TRINITY_DN15777_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_333313 |
Sequence | GGAGTGTGCTAAGTGGTGGAGGTAGTGTTCCGAAGAAACAAGCCTCTGCTGAGGATTGGGTGGACATGGTGAATGATTTTCAAAACGGCGCGTTATCTAC TAGGCTTGGGATTCCAATGATTTATGGGATTGATGCTGTTCATGGCCATAACAATGTCTATAATGCAACAATTTTTCCTCACAATATCGGCCTTGGCGCG ACTCGGGATCCTTCACTTATGAAGAAGATTGGTGAAGCAACTGCTCTTGAAGTTAGAGCAACCGGGATTCAATATGCCTTTTCGCCTTGTATTGCGGTCT GTAGAGATCCGAGGTGGGGCCGGTGTTATGAAAGTTTCAGTGAAGATCATAAAGT BLAST |
Tissue | pods |
Gene name | LI_gene_120902; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_333313
Blastp | Lysosomal beta glucosidase from Dictyostelium with 38.79% of identity |
---|---|
Blastx | Lysosomal beta glucosidase from Dictyostelium with 38.79% of identity |
Eggnog | hydrolase family 3(COG1472) |
Kegg | Link to kegg annotations (DDB_G0292810) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427614.1) |
Pfam | Glycosyl hydrolase family 3 N terminal domain (PF00933.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |