Id Trinity | TRINITY_DN16929_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_328665 |
Sequence | CCAGATGTGTACAGAATATGGATGCCTGATGATGATTGTCCTGGACTAGCAATGTCAAGAGCCTTTGGAGACTTTTGTCTAAAAGATTATGGCCTTATTT CAGCTCCTGATGTCTTTTATAGAAAACTTACAAAACAAGATCAATTTGTGGTTTTGGCAAGTGATGGGGTATGGGATGTGCTCACTAACAGTGAAGTAAT AAACATTGTTGCTTCAGCACCAAGAAGATCCATAGCAGCGAAAATTCTAGTAAAGCGCGCGGTTCGAGCATGGCGATACAAGTATCCCGGTTCGAAGGTT GATGATTGTGCAGCCATATGCTTGTTTGTTGATGACAACCCTGTGCTGTCTCAATCC BLAST |
Tissue | pods |
Gene name | LI_gene_121328; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_328665
Blastp | Probable protein phosphatase 2C 65 from Arabidopsis with 65.79% of identity |
---|---|
Blastx | Probable protein phosphatase 2C 65 from Arabidopsis with 65.79% of identity |
Eggnog | Phosphatase(COG0631) |
Kegg | Link to kegg annotations (AT5G01700) |
CantataDB | Link to cantataDB annotations (CNT0001601) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019450538.1) |
Pfam | Protein phosphatase 2C (PF00481.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |