Id Trinity | TRINITY_DN17748_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_441102 |
Sequence | TGCTGATCATATGGCTTTTTGTTGTGTTAATAATCAATTCAAGCTACACAGCTAGCTTAACATCCATCCTAACAGTGCAACAACTTTCATCACAGATTGA AGGCATTGATAGCTTAACCTCCGGTATTCAACCAATTGGTATTCAAGAAGGCTCATTTGCAAAGAAGTATCTCATTGATGAGCTCAATATAGCACCATCT AGGATAGTTACTTTGAAAAATCCGGATGCATATATCGATGCGCTTTCGCGTGGACCAAACAACGGAGGGGTTCTGGCCGTAGTTGATGAACTTCCTTATA TCGAACâBLAST |
Tissue | pods |
Gene name | LI_gene_121585; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_441102
Blastp | Glutamate receptor 3.4 from Arabidopsis with 73.27% of identity |
---|---|
Blastx | Glutamate receptor 3.4 from Arabidopsis with 73.27% of identity |
Eggnog | PBPe(ENOG410ZZ8P) |
Kegg | Link to kegg annotations (AT1G05200) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019447367.1) |
Pfam | Ligand-gated ion channel (PF00060.25) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |