Id Trinity | TRINITY_DN19782_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_401786 |
Sequence | ACACGATTGGTCGAGACGTCAGGCGGAGATTTGAGACGAGCGATTACAAGCCTTCAGTCTTGTGCGAGGCTCAAAGGTGGCGAACCAATCACAGAAGAGG ACGTCATCGAAGTCGCCGGTGTTGTACCTAAACAATGCATCACTGACATCATCAGCGCTTCTCGTACTAACAGATACGAAACTATTGAAAATTGTCTTGA GAAGATCATGTCTGAAGCGTACTCCGCATCCCAGATACTTGAACAGCTTCAAGAATTTATATTGGATGACCACGAAACTCCTGATATGGCCAAAGCCCAA ATTTGTGAAAAGCTCTCCGTTTGCAATTTTAG BLAST |
Tissue | pods |
Gene name | LI_gene_122248; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_401786
Blastp | Replication factor C subunit 4 from Mus with 36.54% of identity |
---|---|
Blastx | Replication factor C subunit 4 from Mus with 36.54% of identity |
Eggnog | DNA polymerase III subunit delta'(COG0470) |
Kegg | Link to kegg annotations (106344) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020984395.1) |
Pfam | Replication factor C C-terminal domain (PF08542.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |