Id Trinity | TRINITY_DN20523_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_332591 |
Sequence | GAAGAATAGTAATTTACAAGAAAATTGTACCTTCAATGAAAAGTTGAGCCCTAGAGATGACACAAATGGGCATGGTACCCACACCCTATCAACGGCGGGA GGGAGTATCGTCCCATTCGCAAGCTGGGGAGGACTCGCGAATGGGACAGCTAAAGGAATGGCACCAAAAGCTCGATTGGTGGCCTACAAAACGATGTGGA ACGTTCAATGCCCTACATTTAAAACCACGGGAAGCAATGACATAGATATAATGGCTGCTTTCGAAGCTGCTATTGATGATGGCGTTGATGTTATTAGTTT TTCTCAAGCATCAAATAATAGTGCTTATCTTGATGATGGTACTGGAATTGCTACCTTCCATGCCATGAAGAATGGCATCCTCACTATTG BLAST |
Tissue | pods |
Gene name | LI_gene_122489; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_332591
Blastp | Subtilisin-like protease SBT5.4 from Arabidopsis with 50% of identity |
---|---|
Blastx | Subtilisin-like protease SBT5.4 from Arabidopsis with 50% of identity |
Eggnog | peptidase (S8 and S53, subtilisin, kexin, sedolisin(COG1404) |
Kegg | Link to kegg annotations (AT5G59810) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_016186183.1) |
Pfam | Subtilase family (PF00082.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |