Id Trinity | TRINITY_DN21191_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_336269 |
Sequence | TCTCTACATCCTCCACGTCCTCCCAATCTCACACCTCTCGCCCTACCAATCACACACACTCCCGCAAAAATGGTTCACACAAACGGCGCCGCCGCCCAGG GCGAGACTTTCCTTTTCACCTCCGAGTCCGTCGGCCAGGGCCACCCCGACAAGATCGCCGACCAGGTCTCCGACGCCGTTCTCGATGCCTGCCTCAAGGA GGACCCCCTCTCCAAGGTCGCTTGCGAGTGTGCTACCAAGACCGGCATGGTCATGATCTTCGGTGAGATCACCACCAAGACCAAGGTCGACTACCAGAAG GTTGTCCGCGAGGCC BLAST |
Tissue | pods |
Gene name | LI_gene_122706; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_336269
Blastp | S-adenosylmethionine synthase from Neurospora with 82.28% of identity |
---|---|
Blastx | S-adenosylmethionine synthase from Neurospora with 82.28% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (NCU02657) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_007163224.1) |
Pfam | S-adenosylmethionine synthetase, N-terminal domain (PF00438.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |