Id Trinity | TRINITY_DN21273_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_357359 |
Sequence | CAAGGCTCCCAGGATCCGAACCAAGAACTTGATCTCCATCATTTTCTGCGAAGTCGTCGCCATCTACGGTGTCATCATGTCCATTGTCTTTTCCGCAAAG CTGGCCTCGGTGGGCTCTGATGCCGCAAGATCAGGCAGCAACTACTACACTGGTTTCGCTCTCTTCTGGTCTGGTCTCTTGGTCGGCGCTTGCAACTTGG TGTGCGGTGTTTCCGTTGGCATCAACGGTTCCAGTGCTGCTCTTGCAGATGCTGCCGATCCCAGCTTGTTCGTCAAGATCCTGGTCATTGAGATTTTCAG TTCAGTCCTCGGACTCTTCGGTCTCATCATTGGTCTCCTACTCTCCGGTCCCGCCG BLAST |
Tissue | pods |
Gene name | LI_gene_122731; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_357359
Blastp | Probable V-type proton ATPase 20 kDa proteolipid subunit from Schizosaccharomyces with 71.19% of identity |
---|---|
Blastx | Probable V-type proton ATPase 20 kDa proteolipid subunit from Schizosaccharomyces with 70.59% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (SPAC2C4.13) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_016196972.1) |
Pfam | ATP synthase subunit C (PF00137.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |