Id Trinity | TRINITY_DN2165_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_400549 |
Sequence | AATTATCCAGCTCCTTCACATTGGCGTTTGCTGAAAATGAATGCTCCTGAATGGGTAAATGCAGTGCTTGGAGTCTTGGGAGCAATAGGCTCAGGAGCAG TACAACCAATACATGCATATTGTGTAGGAGCACTTATATCATTTTACTTTGATTCTCAAAACTCCAAGGCGAAGTCTAAAACTAGAACCCTGGCCCTCAC TTTCTTAGGAATTGGTGTTTTTAACTTCTTCGCAAGCATTCTCCAACACTATAATTTTGCAATCATGGGAGAGAGGTTGACTAAAAGAATAAGAAAGAAA BLAST |
Tissue | pods |
Gene name | LI_gene_122831; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_400549
Blastp | Putative multidrug resistance protein from Oryza sativa with 51.02% of identity |
---|---|
Blastx | Putative multidrug resistance protein from Oryza sativa with 51.02% of identity |
Eggnog | (ABC) transporter(COG1132) |
Kegg | Link to kegg annotations (4328570) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019451695.1) |
Pfam | ABC transporter transmembrane region (PF00664.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |