Id Trinity | TRINITY_DN21874_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_530710 |
Sequence | ATAAAATACTTCAGCCGCCCCGAAATCGACGACTGGGAATGTCGTAAGGCAATGAATGATATTATGATGGAAGATCTCGTGGCTGATCCAAAGATTATCA TCGCAGCCCTTCACGCTTGCCGACGTCTCAACGACTACGCCATGGGAGTGAGGTTCCTGGAGGCCTGCAAATGGAAGTGTGGAAGCGCAGTGAACGAGAT CTATCCTTACATACTGCAAGAGATCCGTCCAACTTTGGATGAGCTTGGTATGAATACCCCTGAGGAACTAGGCTACGACAAGCCAGACATGTATCTACCT ATTACTGATGAAGTCCACTAGAATAGAAAATTGTTCTAATGATTAGGATACTTTGTCACCTGTTCAAGGTCCTGATACACTTGTGTTACGA BLAST |
Tissue | pods |
Gene name | LI_gene_122882; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_530710
Blastp | Cytochrome c oxidase subunit 5A, mitochondrial from Notamacropus with 63.16% of identity |
---|---|
Blastx | Cytochrome c oxidase subunit 5A, mitochondrial from Notamacropus with 63.16% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (NP_001242246.1) |
Pfam | Cytochrome c oxidase subunit Va (PF02284.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |