Id Trinity | TRINITY_DN23389_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_445466 |
Sequence | ATCAATCCTTCATATTCTGGCAACAAAAACAGATATCTCTATGCTGCAACAACATTAGGATCTCGAAAAACATTGCCAAGTTTTCCTTTTGATACTGTGG TGAAATTAGATTTAGTGAATGATTCTGTACAAACTTGGACTGTTGGAAGTAGAAGGTTTATTGGTGAACCTATTTTTGTTCCCAAAGGTCATGATGAAGA TGATGGCTACCTTCTTGTTGTTGAGTATGCTGTTTCAATGCAGAGATGTTATCTGGTTATCTTGAACCCAAAAAGGATAGGATCATCTAATTCTGTTGTT GCTAG BLAST |
Tissue | pods |
Gene name | LI_gene_123366; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_445466
Blastp | Carotenoid cleavage dioxygenase 7, chloroplastic from Oryza sativa with 54.46% of identity |
---|---|
Blastx | Carotenoid cleavage dioxygenase 7, chloroplastic from Oryza sativa with 54.46% of identity |
Eggnog | dioxygenase(COG3670) |
Kegg | Link to kegg annotations (4336591) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019433092.1) |
Pfam | Retinal pigment epithelial membrane protein (PF03055.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |