Id Trinity | TRINITY_DN24173_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_468477 |
Sequence | TTGCACTTTGTTTGGCTAGGAAATTTGGTACTGCTAAGAACATGGTTGCCACATCTCTAGATTCTATAGAGTCTCTAAGGAAAAAATATACAAATGTGTT ATCCAACTTGACTCAACTCAAGAGTCTTGGTTGTACCATTTTGTATAAAGTTGATGTCCATACCATGACCGAACACCAATTTCTTCAGAGCGAGCACTTC CATGTTATAGTGTTCAATTTTCCTCACGCTGGTTTCATATACCGTGAACATGACTCCCGCCAGATTCAACTCCATAGGAAATTAGTGCGTGGTTTTTTGA ACAGTGCTAAACACA BLAST |
Tissue | pods |
Gene name | LI_gene_123618; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_468477
Blastp | Uncharacterized protein At4g26485 from Arabidopsis with 51.43% of identity |
---|---|
Blastx | Uncharacterized protein At4g26485 from Arabidopsis with 51.43% of identity |
Eggnog | ferredoxin-fold anticodon binding domain containing 1(ENOG41108X7) |
Kegg | Link to kegg annotations (AT4G26485) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_006604988.1) |
Pfam | Domain of unknown function (DUF2431) (PF10354.8) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |