Ll_transcript_443914

• Id Trinity: TRINITY_DN25145_c0_g1_i1
• Name Transcript: Ll_transcript_443914
• Sequence: GAACACCCTATAATTTTGTATGAGGATGATGAAGGTGATAAAATTGTTATTGCCAATGATAATGATCTTATTGCTGCTGTCAGTTGTGCTAGATCTGCAG GACTAAAGGCTTTGAAGTTGAGTTTGGAGTTTGCAGGTTCAGCCAAACCAATAACACTGGAGTATGCTACATCCACTAGACAGAAAATCAGTGAATTGTC TCAATATTCTGGTATTATTGCTGGTGTTGTTGTTCTAACAAGCATTGGTGTTTTGGTCTGCTTAAAGCGCTC
• Tissue: pods
• Gene name: LI_gene_123924;
• Additional information: -

Expression of Ll_transcript_443914

FPKM

• PAB: 0
• PNAB: 0
• PS1: 0
• PS2: 0.3
• PS3: 1.3
• PW1: 0
• PW2: 0
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_443914

• Blastp: -
• Blastx: CBS domain-containing protein CBSCBSPB2 from Arabidopsis with 43.62% of identity
• Eggnog: Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0517)
• Kegg: Link to kegg annotations (AT2G36500)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019429745.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;